Magnus Ehingers undervisning

Allt du behöver för A i Biologi, Kemi, Bioteknik, Gymnasiearbete m.m.

Biologi 1

Administration

Övning i proteinsyntes - med Lego!

Artikelindex

Inledning

Syftet med den här övningen är att du ska förstå hur transkription och translation går till. Du ska också förstå vilken betydelse mutationer kan få för det färdiga proteinet. Allt detta ska du göra genom att bygga "proteiner" av legobitar. 😊 Legobitarna symboliserar de olika aminosyrorna som bygger upp proteinerna.

Protein 1

Följande DNA-sekvens är en gen som kodar för ett visst protein:

AATACGACCTTGATGATTAGA

Börja med att "transkribera" genen till mRNA. Det gör du genom att helt enkelt skriva ner kvävebassekvensen för det mRNA som bildas när genen transkriberas.

Börja sedan på den första tripletten (UUA) och sätt ihop de legobitar som behövs i rätt ordning och sätt ihop dem till ett "protein". Använd dig av den genetiska koden sist på den här sidan.

  1. Vad fick du för figur?

Protein 2

Det här proteinet kommer från en gen med följande DNA-sekvens:

AAGGTAGTGGTATTCACTAGA

Börja med att transkribera DNA-sekvensen till ett mRNA, och translatera sedan mRNA-molekylen till protein med hjälp av den genetiska koden.

  1. Vad fick du för figur den här gången?

Mutation 1

Nu är det dags att göra en mutation i DNA-molekylen som bildar protein 2. Mutationer är helt slumpmässiga. Därför ska du använda en slumptalsgenerator för att bestämma var och hur den sker.

Börja med att bestämma vid vilken kvävebas mutationen ska ske, genom att klicka på "Mutera!" på slumptalsgeneratorn till höger.

Räkna från vänster lika många kvävebaser som slumptalsgeneratorn ovan visar. Den kvävebas du landar på ska bytas ut mot A, T C eller G.

Klicka på "A, T, C eller G" på slumptalsgeneratorn nedan.

1 – Byt ut kvävebasen mot A

2 – Byt ut kvävebasen mot T

3 – Byt ut kvävebasen mot C

4 – Byt ut kvävebasen mot G

Om kvävebasen blir samma som från början, så klicka en gång till, tills det blir någon annan.

Börja med att transkribera DNA-molekylen till mRNA. Translatera sedan mRNA:t till protein genom att bygga det av legobitar (om det går).

  1. Blev det någon förändring? Ibland blir det inte det. (Varför inte?)
  2. Om vi antar att protein 2 ska fungera som "raket i cellen", tror du att det nya proteinet är bättre eller sämre än det gamla? Motivera ditt svar!
  3. Det finns en mutation som skulle kunna ses som positiv för protein 2, även kallat "raketproteinet". Kan du komma på den?
  4. Vilken förändring av DNA-molekylen nedan skulle behövas för att få den mutationen?

AAGGTAGTGGTATTCACTAGA

  1. Vilken är sannolikheten att den mutationen sker i vårt försök?

Mutation 2

Det finns många typer av mutationer. En typ är den du gjorde i mutation 1, där en kvävebas byts ut mot en annan (en substitution). Det kan också vara att långa stycken av DNA-molekylen flyttas eller dupliceras. I den här övningen ska du dock undersöka en annan typ av mutation, där en kvävebas tas bort ur DNA-molekylen (en deletion).

Börja med att bestämma vilken kvävebas som ska tas bort, genom att trycka på "Ta bort!" på slumptalsgeneratorn här till höger.

Räkna från vänster lika många kvävebaser som slumptalsgeneratorn ovan visar. Den kvävebas du landar på ska plockas bort.

Skriv ner sekvensen för den nya DNA-molekylen. Gör sedan som innan att du transkriberar den till mRNA, som du sedan translaterar till protein.

  1. Blev det någon förändring?
  2. Varför är en deletion allvarligare än en substitution?
  3. Har det någon betydelse var i DNA-molekylen deletionen sker? Motivera ditt svar.

Skapa din egen DNA-sekvens

Skriv sekvensen på en gen som kodar för en legobil. Tips: Börja med att bygga bilen!

  1. Vilken blir DNA-sekvensen?
◀ |

 

   

Också intressant: